ID: 1137022976_1137022979

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1137022976 1137022979
Species Human (GRCh38) Human (GRCh38)
Location 16:35448951-35448973 16:35448973-35448995
Sequence CCAGAGATATGTCAGTATCCATT TTTGAGAGAAGAGCCCTGGCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 12, 4: 199} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!