ID: 1137036193_1137036199

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1137036193 1137036199
Species Human (GRCh38) Human (GRCh38)
Location 16:35572044-35572066 16:35572091-35572113
Sequence CCGGACAAAAGAGAATAGTCACA TATGTTACAATGCCCTCTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 56, 4: 361} {0: 1, 1: 11, 2: 104, 3: 429, 4: 868}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!