ID: 1137081421_1137081428

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1137081421 1137081428
Species Human (GRCh38) Human (GRCh38)
Location 16:36063075-36063097 16:36063103-36063125
Sequence CCTTTGTGCATGTGGATATTTGG TTTGTGGCCTATGGTGGAAAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 87, 4: 566} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!