|
Left Crispr |
Right Crispr |
| Crispr ID |
1137241969 |
1137241973 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:46663463-46663485
|
16:46663494-46663516
|
| Sequence |
CCTCCGTCTCCTGGATTCAAGTG |
GCCTCAGCCTCCCGAGTAGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 22, 1: 910, 2: 11219, 3: 45370, 4: 97042} |
{0: 94911, 1: 257638, 2: 218586, 3: 135882, 4: 139272} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|