|
Left Crispr |
Right Crispr |
| Crispr ID |
1137248736 |
1137248743 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:46727781-46727803
|
16:46727813-46727835
|
| Sequence |
CCTCCCGAAGTGCTGAGATTATA |
CACCCCGCCGGGCCTGCCATTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 33, 1: 2798, 2: 53264, 3: 349513, 4: 259944} |
{0: 1, 1: 0, 2: 3, 3: 27, 4: 323} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|