|
Left Crispr |
Right Crispr |
| Crispr ID |
1137259946 |
1137259954 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:46818101-46818123
|
16:46818151-46818173
|
| Sequence |
CCTGACCTCAAGTGATCCATCTG |
TAGGCATGAGTCACCGCCCCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 447, 1: 8809, 2: 38204, 3: 79491, 4: 121025} |
{0: 1, 1: 56, 2: 1981, 3: 22910, 4: 99801} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|