ID: 1137264038_1137264045

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1137264038 1137264045
Species Human (GRCh38) Human (GRCh38)
Location 16:46854112-46854134 16:46854164-46854186
Sequence CCGGCGCTAGATGGCAGCTGTGA ATTAACAATTCCAGCTTGCCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!