ID: 1137268233_1137268237

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1137268233 1137268237
Species Human (GRCh38) Human (GRCh38)
Location 16:46885543-46885565 16:46885559-46885581
Sequence CCAGCCACTTCTGTGGTCTGGGG TCTGGGGACAGTCACCGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 247} {0: 1, 1: 0, 2: 0, 3: 9, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!