ID: 1137288772_1137288780

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1137288772 1137288780
Species Human (GRCh38) Human (GRCh38)
Location 16:47037724-47037746 16:47037745-47037767
Sequence CCGGGAACACAGGGAGGCGGGGG GGGCTCCGGAGGCGGCGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 2, 3: 39, 4: 475} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!