ID: 1137300266_1137300280

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1137300266 1137300280
Species Human (GRCh38) Human (GRCh38)
Location 16:47143026-47143048 16:47143071-47143093
Sequence CCGCAGCCTCCGTGGCCGCAGCA AGGCCCCGTTCCCCGCCGCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 421} {0: 1, 1: 0, 2: 3, 3: 11, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!