|
Left Crispr |
Right Crispr |
| Crispr ID |
1137317094 |
1137317100 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:47337028-47337050
|
16:47337050-47337072
|
| Sequence |
CCAGCTACTTGGGAGGCTGAGGC |
CAGGAGAATCACAGGGAGGCGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 81212, 1: 190903, 2: 234468, 3: 228974, 4: 272812} |
{0: 1, 1: 0, 2: 4, 3: 112, 4: 2909} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|