ID: 1137376052_1137376061

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1137376052 1137376061
Species Human (GRCh38) Human (GRCh38)
Location 16:47952809-47952831 16:47952840-47952862
Sequence CCAAATACAGCAAGGATAAGTGG AGCCAAGCAGTAGGGTGAGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 13, 3: 75, 4: 1438}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!