ID: 1137400971_1137400975

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1137400971 1137400975
Species Human (GRCh38) Human (GRCh38)
Location 16:48154209-48154231 16:48154224-48154246
Sequence CCTAACCTCAACAGACTGGACAG CTGGACAGGCAGAAGCAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 121} {0: 1, 1: 0, 2: 4, 3: 64, 4: 748}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!