ID: 1137401252_1137401265

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1137401252 1137401265
Species Human (GRCh38) Human (GRCh38)
Location 16:48155996-48156018 16:48156049-48156071
Sequence CCCATTCAACTGCCACTCCCACC ATTCCCTCTGCCCACATTAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 310} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!