ID: 1137403482_1137403491

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1137403482 1137403491
Species Human (GRCh38) Human (GRCh38)
Location 16:48172045-48172067 16:48172073-48172095
Sequence CCCCTCCCCACCAGCCCTTGGTA TATTCTACTTTCCATCGATATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 13, 3: 124, 4: 710} {0: 1, 1: 0, 2: 2, 3: 18, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!