ID: 1137408827_1137408832

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1137408827 1137408832
Species Human (GRCh38) Human (GRCh38)
Location 16:48210920-48210942 16:48210941-48210963
Sequence CCTGCCTGCGTGGCCTGAACAAG AGGCTACCTTGGACACCACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 310} {0: 1, 1: 0, 2: 0, 3: 3, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!