ID: 1137426382_1137426404

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1137426382 1137426404
Species Human (GRCh38) Human (GRCh38)
Location 16:48384856-48384878 16:48384906-48384928
Sequence CCCGGCCGGGCCCGCCTCCCGGG CCCTTCCCCCGCCCTCGGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 75, 4: 570} {0: 1, 1: 0, 2: 2, 3: 55, 4: 599}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!