ID: 1137426650_1137426659

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1137426650 1137426659
Species Human (GRCh38) Human (GRCh38)
Location 16:48385695-48385717 16:48385733-48385755
Sequence CCGTCGGCTCAGGGCAGCTCCTC CCGGGGCCGCGTGACCCCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 219} {0: 1, 1: 0, 2: 1, 3: 17, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!