ID: 1137454409_1137454413

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1137454409 1137454413
Species Human (GRCh38) Human (GRCh38)
Location 16:48607497-48607519 16:48607532-48607554
Sequence CCAGGGCAGGAGAATGACTTTTT CTCTAACACAAGTTGAACCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 428} {0: 1, 1: 0, 2: 0, 3: 4, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!