ID: 1137468028_1137468034

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1137468028 1137468034
Species Human (GRCh38) Human (GRCh38)
Location 16:48729007-48729029 16:48729059-48729081
Sequence CCTCTTGTCCACTCTACTCCAGC TGCTAAGCCCATCCTGCTCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 71, 4: 447} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!