ID: 1137483402_1137483408

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1137483402 1137483408
Species Human (GRCh38) Human (GRCh38)
Location 16:48871306-48871328 16:48871332-48871354
Sequence CCTCCATCTGGACTGGTGAGTTT CTGGAGAAGAGGAAAGAGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 28, 3: 176, 4: 1610}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!