ID: 1137495369_1137495374

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1137495369 1137495374
Species Human (GRCh38) Human (GRCh38)
Location 16:48965295-48965317 16:48965313-48965335
Sequence CCTGCAAGCCCGCTAACTCTGTG CTGTGTAGACAGATGAAGGAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!