ID: 1137533065_1137533070

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1137533065 1137533070
Species Human (GRCh38) Human (GRCh38)
Location 16:49295734-49295756 16:49295758-49295780
Sequence CCTTCATCTTGCTGGGGCGCCAA TCAGTGATGGAGCGGCTCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 57} {0: 1, 1: 0, 2: 0, 3: 12, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!