ID: 1137546861_1137546870

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1137546861 1137546870
Species Human (GRCh38) Human (GRCh38)
Location 16:49410795-49410817 16:49410847-49410869
Sequence CCAAGAAGGGGCAGCAACTGACC AGAGGTGGTGACATTTGCATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 134} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!