ID: 1137553649_1137553657

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1137553649 1137553657
Species Human (GRCh38) Human (GRCh38)
Location 16:49456674-49456696 16:49456718-49456740
Sequence CCATCCATCTGCACTGTCTACTT CCTGGGGCCAAGAAGCCTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 253} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!