ID: 1137565287_1137565292

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1137565287 1137565292
Species Human (GRCh38) Human (GRCh38)
Location 16:49528887-49528909 16:49528920-49528942
Sequence CCATCACTCTCACCCCGCAGGCG CTCGTTCCACCCCAAGATGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 161} {0: 1, 1: 0, 2: 2, 3: 7, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!