ID: 1137568323_1137568327

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1137568323 1137568327
Species Human (GRCh38) Human (GRCh38)
Location 16:49548151-49548173 16:49548166-49548188
Sequence CCTCACCCAGTGGGTCCTCCAAG CCTCCAAGCACCTCCCAGTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 224} {0: 1, 1: 0, 2: 2, 3: 12, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!