ID: 1137577823_1137577825

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1137577823 1137577825
Species Human (GRCh38) Human (GRCh38)
Location 16:49615240-49615262 16:49615257-49615279
Sequence CCAGGTAAAATACAGGACGGCAG CGGCAGGCAAATGCAAATTTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 131} {0: 1, 1: 0, 2: 0, 3: 4, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!