ID: 1137580784_1137580792

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1137580784 1137580792
Species Human (GRCh38) Human (GRCh38)
Location 16:49632356-49632378 16:49632400-49632422
Sequence CCTCAGGGAGGGAAGGGGTGGGC TCCCCAGGTGTGCCCACACAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 65, 4: 717} {0: 1, 1: 0, 2: 2, 3: 20, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!