ID: 1137581020_1137581023

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1137581020 1137581023
Species Human (GRCh38) Human (GRCh38)
Location 16:49633655-49633677 16:49633668-49633690
Sequence CCTGAGAGCACCTATGCCCCCCT ATGCCCCCCTAGAAAGGCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 131} {0: 1, 1: 0, 2: 0, 3: 8, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!