ID: 1137581181_1137581192

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1137581181 1137581192
Species Human (GRCh38) Human (GRCh38)
Location 16:49634522-49634544 16:49634541-49634563
Sequence CCCTCTGCCCTCCTCACCCCCTC CCTCAAAATCACAGGGTCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 17, 3: 289, 4: 2298} {0: 1, 1: 0, 2: 1, 3: 15, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!