ID: 1137601767_1137601772

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1137601767 1137601772
Species Human (GRCh38) Human (GRCh38)
Location 16:49761092-49761114 16:49761106-49761128
Sequence CCCTTTGCCTCCCAAACACAGTG AACACAGTGTGACCTGAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 209} {0: 1, 1: 0, 2: 1, 3: 18, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!