ID: 1137614164_1137614179

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1137614164 1137614179
Species Human (GRCh38) Human (GRCh38)
Location 16:49837143-49837165 16:49837177-49837199
Sequence CCCTCCACCTCCCACCCCAGTAA GGCCCTGGCGAGCTGAGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 73, 4: 638} {0: 1, 1: 0, 2: 2, 3: 42, 4: 361}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!