ID: 1137614174_1137614179

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1137614174 1137614179
Species Human (GRCh38) Human (GRCh38)
Location 16:49837157-49837179 16:49837177-49837199
Sequence CCCCAGTAATGTACAGAGGGGGC GGCCCTGGCGAGCTGAGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 78} {0: 1, 1: 0, 2: 2, 3: 42, 4: 361}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!