ID: 1137629208_1137629218

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1137629208 1137629218
Species Human (GRCh38) Human (GRCh38)
Location 16:49930463-49930485 16:49930516-49930538
Sequence CCAGAGGGGTAGGCAAAAAACGC GCAGCATAGAGCAGGCACATGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 18, 4: 233}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!