ID: 1137665301_1137665321

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1137665301 1137665321
Species Human (GRCh38) Human (GRCh38)
Location 16:50246103-50246125 16:50246153-50246175
Sequence CCTGCGGCCGCTCCTCCTTCCCC CTGCCACTGGGGCGGCCACTCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 23, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!