ID: 1137667880_1137667884

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1137667880 1137667884
Species Human (GRCh38) Human (GRCh38)
Location 16:50262233-50262255 16:50262262-50262284
Sequence CCCTGCTGGGTACTTCTCCTCAG TTTTTTTTTTTTTTGAGACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 175} {0: 13494, 1: 16907, 2: 33917, 3: 145359, 4: 149502}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!