ID: 1137669751_1137669763

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1137669751 1137669763
Species Human (GRCh38) Human (GRCh38)
Location 16:50272201-50272223 16:50272245-50272267
Sequence CCTGGAAGGCAGAAGGTACCTGC CCTTCTAGGGCCCGGATCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 216} {0: 1, 1: 0, 2: 1, 3: 9, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!