ID: 1137674024_1137674034

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1137674024 1137674034
Species Human (GRCh38) Human (GRCh38)
Location 16:50294949-50294971 16:50295000-50295022
Sequence CCCAGAGTGACAGGCCAGTGGGG CTGGGGCTCTGGAGCTCAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 212} {0: 1, 1: 0, 2: 5, 3: 46, 4: 417}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!