ID: 1137702310_1137702318

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1137702310 1137702318
Species Human (GRCh38) Human (GRCh38)
Location 16:50506162-50506184 16:50506196-50506218
Sequence CCTCTGGGGCTGAAGATCTGCCT GGAGGTCACAGGTTCCAGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 218} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!