ID: 1137731571_1137731574

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1137731571 1137731574
Species Human (GRCh38) Human (GRCh38)
Location 16:50693963-50693985 16:50693980-50694002
Sequence CCTGGAGGATCCTGCTGCTGCTC CTGCTCTCTGTACCTCTTATGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 46, 4: 368} {0: 1, 1: 0, 2: 3, 3: 21, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!