ID: 1137739384_1137739391

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1137739384 1137739391
Species Human (GRCh38) Human (GRCh38)
Location 16:50752680-50752702 16:50752733-50752755
Sequence CCCAACCTCTGCTAACCACAATT TTCTAGGCTCCTCATAAGAGTGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 50, 3: 613, 4: 2302} {0: 1, 1: 0, 2: 4, 3: 37, 4: 299}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!