ID: 1137739386_1137739391

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1137739386 1137739391
Species Human (GRCh38) Human (GRCh38)
Location 16:50752685-50752707 16:50752733-50752755
Sequence CCTCTGCTAACCACAATTTCTTC TTCTAGGCTCCTCATAAGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 310} {0: 1, 1: 0, 2: 4, 3: 37, 4: 299}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!