|
Left Crispr |
Right Crispr |
| Crispr ID |
1137740749 |
1137740753 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:50770603-50770625
|
16:50770620-50770642
|
| Sequence |
CCCGAGCCCAGCTAATTTTTGTG |
TTTGTGTTCTTAGTAGAGAGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 7, 2: 121, 3: 907, 4: 1937} |
{0: 2, 1: 204, 2: 14853, 3: 270022, 4: 189082} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|