|
Left Crispr |
Right Crispr |
| Crispr ID |
1137740749 |
1137740756 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:50770603-50770625
|
16:50770640-50770662
|
| Sequence |
CCCGAGCCCAGCTAATTTTTGTG |
AGGGTTTCACCATGTTGGCCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 7, 2: 121, 3: 907, 4: 1937} |
{0: 29630, 1: 119747, 2: 180457, 3: 189702, 4: 141729} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|