ID: 1137786379_1137786383

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1137786379 1137786383
Species Human (GRCh38) Human (GRCh38)
Location 16:51140774-51140796 16:51140791-51140813
Sequence CCGCAGATGTTGCACTTGAATGG GAATGGCCTCTCTCCGGTATGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 13, 4: 127} {0: 1, 1: 0, 2: 1, 3: 5, 4: 56}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!