ID: 1137804266_1137804273

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1137804266 1137804273
Species Human (GRCh38) Human (GRCh38)
Location 16:51288629-51288651 16:51288656-51288678
Sequence CCTTCCACCAGCCTTCCAGCCAG CATCCCTTTGTTCATGCCCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 10, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!