ID: 1137824184_1137824188

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1137824184 1137824188
Species Human (GRCh38) Human (GRCh38)
Location 16:51475653-51475675 16:51475688-51475710
Sequence CCAGTACAACGTTGAATAGAAGT CCTGTACTGGTGCTGATTTTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!