ID: 1137855751_1137855755

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1137855751 1137855755
Species Human (GRCh38) Human (GRCh38)
Location 16:51792927-51792949 16:51792980-51793002
Sequence CCCTTCCTAGGGCGCGCGCGCGC ACACACACACACACTAGGTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 6, 2: 53, 3: 466, 4: 2335}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!