ID: 1137862329_1137862341

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1137862329 1137862341
Species Human (GRCh38) Human (GRCh38)
Location 16:51858643-51858665 16:51858679-51858701
Sequence CCCCTATGTGGGTGGAGCAGCTG AGGTACACAGGGAAGGGACAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 45, 4: 478}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!